Stem-loop sequence gma-MIR394e

AccessionMI0019775 (change log)
DescriptionGlycine max miR394e stem-loop
Gene family MIPF0000100; MIR394
Literature search

8 open access papers mention gma-MIR394e
(12 sentences)

Stem-loop
   -  u    au      auu   u         -uuaa     ---aau    u   u 
5'  ca agcc  uuuggc   cug ccaccucca     uauua      gggu guu u
    || ||||  ||||||   ||| |||||||||     |||||      |||| |||  
3'  gu ucgg  aaaccg   gac gguggaggu     guggu      ccca uaa a
   u  c    gc      gau   c         ugacg     aaaacc    c   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr5: 36014286-36014396 [+]
intergenic
Database links

Mature sequence gma-miR394e

Accession MIMAT0023230
Sequence

11 - 

uuggcauucuguccaccucc

 - 30

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).