Stem-loop sequence gma-MIR171r

AccessionMI0019774 (change log)
DescriptionGlycine max miR171r stem-loop
Gene family MIPF0000104; MIR171_2
Literature search

15 open access papers mention gma-MIR171r
(36 sentences)

Stem-loop
   g     g     c         c   u    a    ugcauaugaauuuc 
5'  aagug acugg gugguauug uuc gcuc ucuu              a
    ||||| ||||| ||||||||| ||| |||| ||||              u
3'  uucac ugacc caccauaac aag cgag agaa              c
   -     a     u         u   c    c    uaaauuucccuaca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr4: 50116148-50116249 [+]
intergenic
Clustered miRNAs
< 10kb from gma-MIR171r
gma-MIR171bchr4: 50115835-50115926 [+]
gma-MIR171rchr4: 50116148-50116249 [+]
Database links

Mature sequence gma-miR171r

Accession MIMAT0023229
Sequence

72 - 

cgagccgaaucaauaccacuc

 - 92

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).