Stem-loop sequence gma-MIR399c

AccessionMI0019773 (change log)
DescriptionGlycine max miR399c stem-loop
Gene family MIPF0000015; MIR399
Literature search

14 open access papers mention gma-MIR399c
(90 sentences)

Stem-loop
   aaac    u       uu     ua         aau    a   cca 
5'     cagc auagggc  cucuu  uuggcagga   uauc uga   c
       |||| |||||||  |||||  |||||||||   |||| |||    
3'     gucg ugucccg  gagag  aaccguucu   auag acu   u
   uuuc    u       uu     ga         ---    -   acu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr20: 39360463-39360556 [-]
intergenic
Clustered miRNAs
< 10kb from gma-MIR399c
gma-MIR399cchr20: 39360463-39360556 [-]
gma-MIR399ochr20: 39357304-39357414 [-]
Database links

Mature sequence gma-miR399c

Accession MIMAT0023228
Sequence

64 - 

ugccaaaggagaguugcccug

 - 84

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).