Stem-loop sequence gma-MIR482e

AccessionMI0019772 (change log)
DescriptionGlycine max miR482e stem-loop
Gene family MIPF0000403; MIR482
Literature search

21 open access papers mention gma-MIR482e
(44 sentences)

Stem-loop
   --agacaaaauu           ug           -auu           uc    ag 
5'             gggggaaggca  gguaugggggg    gggaaggaaua  caua  c
               |||||||||||  |||||||||||    |||||||||||  ||||  a
3'             cuccuuuuugu  ccauacccucc    cccuucuuuau  guau  a
   cccccucuuucu           ca           acau           -c    aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence gma-miR482e

Accession MIMAT0023227
Sequence

26 - 

uauggggggauugggaaggaa

 - 46

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).