Stem-loop sequence gma-MIR2606a

AccessionMI0019771 (change log)
DescriptionGlycine max miR2606a stem-loop
Gene family MIPF0000888; MIR2606
Literature search

1 open access papers mention gma-MIR2606a
(1 sentences)

Stem-loop
   a       u    a           u           c       uca        c a       c    a    cuc   auaaa     gc 
5'  aagcuua auac guuccuuaggu cuuuuggugcu uucuuca   auuagaau g aguuuca cuug uaau   uua     gguuu  a
    ||||||| |||| ||||||||||| ||||||||||| |||||||   |||||||| | ||||||| |||| ||||   |||     |||||  u
3'  uuugaau uaug caaggaauuca gaaaaccacga aagaagu   uaguuuua c uuaaagu gagc auua   aau     cuaga  u
   c       c    g           c           u       ---        a c       u    c    ---   -acaa     aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr20: 34012454-34012637 [+]
intergenic
Database links

Mature sequence gma-miR2606a

Accession MIMAT0023226
Sequence

154 - 

aaaagcacuuaaggaacggua

 - 174

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).