Stem-loop sequence gma-MIR156t

AccessionMI0019770
DescriptionGlycine max miR156t stem-loop
Gene family MIPF0000008; MIR156
Stem-loop
   cuuuua           -        -      a   u    uua    a 
5'       gagauugacag aagaaagg gagcac uac gcaa   uaug a
         ||||||||||| |||||||| |||||| ||| ||||   ||||  
3'       cucuaacuguc uucuuuuc cucgug gug cguu   auac c
   auuaug           g        u      c   c    ucc    a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0) Overlapping transcripts
chr1: 55282671-55282770 [+]
intergenic

Mature sequence gma-miR156t

Accession MIMAT0023225
Sequence

11 - 

uugacagaagaaagggagcac

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).