Stem-loop sequence gma-MIR166k

AccessionMI0019768 (change log)
DescriptionGlycine max miR166k stem-loop
Gene family MIPF0000004; MIR166
Literature search

36 open access papers mention gma-MIR166k
(210 sentences)

Stem-loop
   gg      uu             a   a      ucacaucauauauauaucuucuucuucaauuucccuuuccuucuugauuua 
5'   gggugu  ggaaugagguuug ucc agauca                                                   c
     ||||||  ||||||||||||| ||| ||||||                                                    
3'   uccaca  ccuuacuucggac agg ucuagu                                                   u
   aa      cu             c   c      cagaguaggguacguacuucacuacuuuuauuauuauauacauacuuccau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr19: 36827774-36827945 [-]
intergenic
Database links

Mature sequence gma-miR166k

Accession MIMAT0023223
Sequence

142 - 

ucucggaccaggcuucauucc

 - 162

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).