Stem-loop sequence gma-MIR5786

AccessionMI0019767 (change log)
DescriptionGlycine max miR5786 stem-loop
Literature search

1 open access papers mention gma-MIR5786
(1 sentences)

Stem-loop
   g                      a         g    gcaugaugaugcaugcaaaaauauauuaugu 
5'  agagagucuugucgcaggauag gggcacugg uaug                               g
    |||||||||||||||||||||| ||||||||| ||||                               u
3'  ucucuuagaacagcguucuguc ccugugauc auau                               g
   g                      -         g    aaauauuuauguacgaauuaauacuaaaguc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr19: 1947621-1947760 [+]
intergenic
Database links

Mature sequence gma-miR5786

Accession MIMAT0023222
Sequence

11 - 

ugucgcaggauagagggcacu

 - 31

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).
2