Stem-loop sequence gma-MIR396k

AccessionMI0019764 (change log)
DescriptionGlycine max miR396k stem-loop
Gene family MIPF0000047; MIR396
Literature search

25 open access papers mention gma-MIR396k
(145 sentences)

Stem-loop
   uuccucuc   u    ----      c                   a     uau  aucuuauaucucuc 
5'         aag ccug    gucaug uuuuccacagcuuucuuga cuucu   gc              c
           ||| ||||    |||||| ||||||||||||||||||| |||||   ||              a
3'         uuc ggac    cgguau agagggugucgaaagaacu gaaga   cg              c
   -guuaauu   -    uuaa      a                   c     ucc  aauuuuacgaccuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence gma-miR396k-5p

Accession MIMAT0032132
Sequence

26 - 

uuccacagcuuucuugaacuu

 - 46

Get sequence
Evidence experimental; Illumina [2]

Mature sequence gma-miR396k-3p

Accession MIMAT0023219
Previous IDsgma-miR396k
Sequence

94 - 

gcucaagaaagcugugggaga

 - 114

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).
2