Stem-loop sequence gma-MIR169s

AccessionMI0019763 (change log)
DescriptionGlycine max miR169s stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

23 open access papers mention gma-MIR169s
(98 sentences)

Stem-loop 
   - ga gg    a          g         a  cau    -caug g     -     u 
5'  g  u  aaug agccaaggau acuugccgg gu   auuc     u augau gaggc a
    |  |  |||| |||||||||| ||||||||| ||   ||||     | ||||| ||||| a
3'  c  g  uuac ucgguuucua ugaacggcc ca   ugag     a ugcua uuucg a
   u uc uu    g          a         -  -au    uuaaa g     g     u
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr17: 4594138-4594257 [-]
intergenic
Clustered miRNAs
< 10kb from gma-MIR169s
gma-MIR169schr17: 4594138-4594257 [-]
gma-MIR169gchr17: 4591798-4591927 [-]
gma-MIR169rchr17: 4587059-4587161 [-]
Database links

Mature sequence gma-miR169s-5p

Accession MIMAT0023218
Sequence

11 -  

aagccaaggaugacuugccgg

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence gma-miR169s-3p

Accession MIMAT0037454
Sequence

90 -  

cggcaaguaaucuuuggcugc

 - 110

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).
2
PMID:25747880 "Evolutionary patterns and coevolutionary consequences of MIRNA genes and microRNA targets triggered by multiple mechanisms of genomic duplications in soybean" Zhao M, Meyers BC, Cai C, Xu W, Ma J Plant Cell. 27:546-562(2015).