Stem-loop sequence gma-MIR156s

AccessionMI0019761
DescriptionGlycine max miR156s stem-loop
Gene family MIPF0000008; MIR156
Stem-loop
   ----cuuc   uuu  uaauuugu  a         -             u     cuuucc           
5'         agg   gu        gg ggugacaga agagagugagcac uggcu      uagcauggau 
           |||   ||        || ||||||||| ||||||||||||| |||||      ||||||||| c
3'         ucc   ca        cc ccacugucu ucucuuacucgug gucga      aucgugcuuu 
   uucuccuc   -cu  -uuuuccu  a         a             u     ----aa           
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0) Overlapping transcripts
chr17: 4291644-4291777 [-]
intergenic

Mature sequence gma-miR156s

Accession MIMAT0023216
Sequence

26 - 

ugacagaagagagugagcacu

 - 46

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).