Stem-loop sequence gma-MIR171q

AccessionMI0019760 (change log)
DescriptionGlycine max miR171q stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

15 open access papers mention gma-MIR171q
(36 sentences)

Stem-loop
   -u    ------  u  a        ug             -- g    u     aug 
5'   gaga      ac ug gauauugg  cgguucaaucaga  a gcag guuuu   a
     ||||      || || ||||||||  |||||||||||||  | |||| |||||    
3'   cucu      ug ac cuauaacc  gccgaguuaguuu  u uguc caaaa   u
   gg    acuuaa  u  a        gu             au g    u     acc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr17: 1001169-1001277 [+]
intergenic
Database links

Mature sequence gma-miR171q

Accession MIMAT0023215
Sequence

74 - 

uugagccgugccaauaucaca

 - 94

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).