Stem-loop sequence gma-MIR396j

AccessionMI0019759 (change log)
DescriptionGlycine max miR396j stem-loop
Gene family MIPF0000047; MIR396
Literature search

26 open access papers mention gma-MIR396j
(146 sentences)

Stem-loop
   g     c     c          u       cugcauguguguugugaggcuucuccagugaaggu 
5'  guuuu gugau uuccacaguu ucuugaa                                   u
    ||||| ||||| |||||||||| |||||||                                   u
3'  uagag cacua aaggugucga agaacuu                                   a
   -     u     a          u       aacacgaguaucuuauagacgugaacguauccucu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr16: 31530670-31530803 [-]
intergenic
Database links

Mature sequence gma-miR396j

Accession MIMAT0023214
Sequence

104 - 

auucaagauagcuguggaaaa

 - 124

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).