Stem-loop sequence gma-MIR399b

AccessionMI0019758 (change log)
DescriptionGlycine max miR399b stem-loop
Gene family MIPF0000015; MIR399
Literature search

14 open access papers mention gma-MIR399b
(90 sentences)

Stem-loop
   c        a        c      cc        -----------        a 
5'  aaaucagc auagggca cucucu  uggcaggu           auuuuugg g
    |||||||| |||||||| ||||||  ||||||||           |||||||| c
3'  uuuggucg ugucccgu gagagg  accguuca           uaaaaacc u
   -        g        u      aa        auaacuguaac        a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr16: 36115809-36115909 [+]
intergenic
Clustered miRNAs
< 10kb from gma-MIR399b
gma-MIR399nchr16: 36109955-36110082 [+]
gma-MIR399bchr16: 36115809-36115909 [+]
Database links

Mature sequence gma-miR399b

Accession MIMAT0023213
Sequence

71 - 

ugccaaaggagaguugcccug

 - 91

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).