Stem-loop sequence gma-MIR156r

AccessionMI0019757 (change log)
DescriptionGlycine max miR156r stem-loop
   u    ---aau        uc      a    uaugggguucgugaucauaauaugaugacaauccuaaugcauaauauucuuu 
5'  uguu      ugcuuuuu  ucuucu guua                                                    c
    ||||      ||||||||  |||||| ||||                                                    g
3'  acaa      acgagaga  agaaga cagu                                                    u
   u    gucgau        -u      -    cguccgagauagaauacguacacgaacuaggaagugagagagacguauuuua 
Get sequence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr16: 6633951-6634116 [+]
Database links

Mature sequence gma-miR156r

Accession MIMAT0023212

136 - 


 - 156

Get sequence
Evidence experimental; Illumina [1]


PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).