Stem-loop sequence gma-MIR169p

AccessionMI0019756 (change log)
DescriptionGlycine max miR169p stem-loop
Gene family MIPF0001058; MIR169_6
Literature search

23 open access papers mention gma-MIR169p
(98 sentences)

Stem-loop
   -        uu      aa    ga          ---ugug      cuu 
5'  gaguacga  ugagcc  ggau  cuugccgaca       gaaaag   a
    ||||||||  ||||||  ||||  ||||||||||       ||||||    
3'  cucguguu  acucgg  ucua  gagcggcugu       cuuuuc   a
   c        -u      -g    ag          uguggaa      ccu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr15: 14192081-14192178 [+]
intergenic
Clustered miRNAs
< 10kb from gma-MIR169p
gma-MIR169dchr15: 14186946-14187033 [+]
gma-MIR169pchr15: 14192081-14192178 [+]
Database links

Mature sequence gma-miR169p

Accession MIMAT0023211
Sequence

11 - 

ugagccaaggaugacuugccg

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).