Stem-loop sequence gma-MIR394d

AccessionMI0019755 (change log)
DescriptionGlycine max miR394d stem-loop
Gene family MIPF0000100; MIR394
Literature search

8 open access papers mention gma-MIR394d
(12 sentences)

Stem-loop
   -      - -au        u   u         -u    ga 
5'  cauaga c   uuuggcau cug ccaccucca  uggu  u
    |||||| |   |||||||| ||| |||||||||  ||||  g
3'  gugucu g   aaaccgua gac gguggaggu  accg  a
   u      c ggc        u   c         uu    gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr15: 3785393-3785475 [+]
intergenic
Database links

Mature sequence gma-miR394d

Accession MIMAT0023210
Sequence

11 - 

uuggcauucuguccaccucc

 - 30

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).