Stem-loop sequence gma-MIR171p

AccessionMI0019753 (change log)
DescriptionGlycine max miR171p stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

16 open access papers mention gma-MIR171p
(52 sentences)

Stem-loop
   gaagugcuauauuauacuaauuagcaca  a    u          c    c       u  a      a  -   au 
5'                             ug caaa uaagguauug cgug cucaauc ga uacaug cu auu  a
                               || |||| |||||||||| |||| ||||||| || |||||| || |||  a
3'                             ac guuu auucuauaac gcgc gaguuag uu auguac ga uaa  c
   -------------------------uuc  -    u          u    c       u  c      c  c   aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr13: 40504444-40504575 [-]
intergenic
Database links

Mature sequence gma-miR171p

Accession MIMAT0023208
Sequence

102 - 

uugagccgcgucaauaucuua

 - 122

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).