Stem-loop sequence gma-MIR169o

AccessionMI0019751 (change log)
DescriptionGlycine max miR169o stem-loop
Gene family MIPF0001058; MIR169_6
Literature search

23 open access papers mention gma-MIR169o
(98 sentences)

Stem-loop
   a        u     ca        u       uaugcuuaaaagcaaa 
5'  gaguagau ugagc  ggauggcu gccggca                g
    |||||||| |||||  |||||||| |||||||                 
3'  cuuguuua acucg  ccuaccgg uggucgu                a
   c        u     ua        -       ugugggaguauccccu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr13: 21496986-21497084 [+]
intergenic
Clustered miRNAs
< 10kb from gma-MIR169o
gma-MIR169mchr13: 21492366-21492488 [+]
gma-MIR169ochr13: 21496986-21497084 [+]
gma-MIR169ichr13: 21505359-21505509 [+]
Database links

Mature sequence gma-miR169o

Accession MIMAT0023206
Sequence

11 - 

ugagccaggauggcuugccggc

 - 32

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).