Stem-loop sequence gma-MIR172l

AccessionMI0019750 (change log)
DescriptionGlycine max miR172l stem-loop
Gene family MIPF0000035; MIR172
Literature search

27 open access papers mention gma-MIR172l
(123 sentences)

Stem-loop
   caguc   a         g           a   ugc    ucagc        c  gacugua     uuauacauacauauauauaca 
5'      ugc ggugcagcg caucaagauuc cac   cuaa     uaggacuu au       cacgc                     u
        ||| ||||||||| ||||||||||| |||   ||||     |||||||| ||       |||||                     g
3'      acg cuacgucgu guaguucuaag gug   gauu     aucuugaa ua       gugug                     u
   cauaa   a         a           g   -ua    ---uu        a  -aguaag     agcagguguuucucgguugca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr13: 43075243-43075420 [+]
intergenic
Database links

Mature sequence gma-miR172l

Accession MIMAT0023205
Sequence

148 - 

ggaaucuugaugaugcugcau

 - 168

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).