Stem-loop sequence gma-MIR171o

AccessionMI0019749 (change log)
DescriptionGlycine max miR171o stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

16 open access papers mention gma-MIR171o
(37 sentences)

Stem-loop
   u   --g  u  a                       a  c  u      ug 
5'  aag   gc ug gauauugguacgguucaaucaga ga ag gcuuua  a
    |||   || || ||||||||||||||||||||||| || || ||||||   
3'  uuc   cg ac cuauaaccgugccgaguuaguuu uu uc cgaaau  u
   u   aaa  u  a                       a  c  u      cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr13: 31863180-31863281 [+]
intergenic
Database links

Mature sequence gma-miR171o-5p

Accession MIMAT0032131
Sequence

11 - 

agauauugguacgguucaauc

 - 31

Get sequence
Evidence experimental; Illumina [2]

Mature sequence gma-miR171o-3p

Accession MIMAT0023204
Previous IDsgma-miR171o
Sequence

72 - 

uugagccgugccaauaucaca

 - 92

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).
2