Stem-loop sequence gma-MIR156q

AccessionMI0019748
DescriptionGlycine max miR156q stem-loop
Gene family MIPF0000008; MIR156
Stem-loop
   uuugu  a         -      u      u     c   ccua  a     c 
5'      gg ggugacaga agagag gagcac uggcu uuu    gc uggau u
        || ||||||||| |||||| |||||| ||||| |||    || |||||  
3'      cc ccacugucu ucucuc cucgug gccga aaa    cg acuug a
   uuccu  a         a      u      u     -   ---c  c     a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0) Overlapping transcripts
chr13: 20521462-20521566 [+]
intergenic

Mature sequence gma-miR156q

Accession MIMAT0023203
Sequence

11 - 

ugacagaagagagugagcacu

 - 31

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).
2