Stem-loop sequence gma-MIR172k

AccessionMI0019746 (change log)
DescriptionGlycine max miR172k stem-loop
Gene family MIPF0000035; MIR172
Literature search

27 open access papers mention gma-MIR172k
(123 sentences)

Stem-loop
   uuguuu  g         c             a   ----     aa       g  a uau  u   au 
5'       gc gauguagca caucaagauucac ugc    aaaug  ggugggu gg c   ga gca  c
         || ||||||||| ||||||||||||| |||    |||||  ||||||| || |   || |||  u
3'       cg cuacgucgu guaguucuaagug gug    uuuau  uuaccua cc g   cu cgu  a
   aaauac  a         a             -   guuu     gg       a  - --u  -   ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr12: 33517484-33517617 [+]
intergenic
Database links

Mature sequence gma-miR172k

Accession MIMAT0023201
Sequence

104 - 

ugaaucuugaugaugcugcau

 - 124

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).