Stem-loop sequence gma-MIR171m

AccessionMI0019745 (change log)
DescriptionGlycine max miR171m stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

15 open access papers mention gma-MIR171m
(36 sentences)

Stem-loop
   ---    -  uu uau    ca   auca             c       u   -g        aagau 
5'    gaag ug  g   gaag  caa    agguauuggcgug cucaauu gaa  acaugguu     g
      |||| ||  |   ||||  |||    ||||||||||||| ||||||| |||  ||||||||      
3'    cuuc ac  u   cuuc  guu    ucuauaacugcgc gaguuaa uuu  uguaccga     a
   cua    u  cu --u    ac   cuac             c       u   aa        ccaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr12: 8432426-8432558 [+]
intergenic
Database links

Mature sequence gma-miR171m

Accession MIMAT0023200
Sequence

88 - 

uugagccgcgucaauaucuca

 - 108

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).