Stem-loop sequence gma-MIR156p

AccessionMI0019741
DescriptionGlycine max miR156p stem-loop
Gene family MIPF0000008; MIR156
Stem-loop
   cuuugg           -        -      au  u    uua   ca 
5'       gagauugacag aagaaagg gagcac  gc gcaa   uau  a
         ||||||||||| |||||||| ||||||  || ||||   |||   
3'       cucuaacuguc uucuuuuc cucgug  ug cguu   aua  c
   acuaag           c        u      cg  c    ucc   ca 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0) Overlapping transcripts
chr11: 453213-453312 [-]
intergenic

Mature sequence gma-miR156p

Accession MIMAT0023196
Sequence

11 - 

uugacagaagaaagggagcac

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).