Stem-loop sequence gma-MIR5774b

AccessionMI0019738 (change log)
DescriptionGlycine max miR5774b stem-loop
Gene family MIPF0001567; MIR5774
Literature search

1 open access papers mention gma-MIR5774b
(2 sentences)

Stem-loop
   aa                                          ------   a        g    agg   u   agcu 
5'   gaguuugggcuggcgucgacacguggcaugagacuagucagu      ggc auuugcag uagc   gcu cuc    u
     ||||||||||||||||||||||||||||||||||||||||||      ||| |||||||| ||||   ||| |||     
3'   cucaaacccgacugcagcugugcacuguacucugaucgguca      ccg uaaacguc auug   cga ggg    u
   ug                                          gguuaa   c        -    gga   u   acuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr9: 49753426-49753582 [-]
intergenic
Database links

Mature sequence gma-miR5774b

Accession MIMAT0023193
Sequence

11 - 

gcuggcgucgacacguggcau

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).