Stem-loop sequence gma-MIR5559

AccessionMI0019713 (change log)
DescriptionGlycine max miR5559 stem-loop
Gene family MIPF0001606; MIR5559
Literature search

2 open access papers mention gma-MIR5559
(3 sentences)

Stem-loop
   uauu         u       u          c       caa  aaccauauuggauuuggagcuucau 
5'     uccuuuuac uggugaa uguuggauca ucugugu   cc                         g
       ||||||||| ||||||| |||||||||| |||||||   ||                         c
3'     aggaaaaug aucacuu acaaccuagu agauaua   gg                         a
   cguu         u       u          a       -aa  agaccgaacguagagaaaacagaag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr19: 776239-776380 [+]
intergenic
Database links

Mature sequence gma-miR5559

Accession MIMAT0023168
Sequence

11 - 

uacuuggugaauuguuggauc

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).