Stem-loop sequence sha-mir-130a

AccessionMI0019659 (change log)
DescriptionSarcophilus harrisii miR-130a stem-loop
Gene family MIPF0000034; mir-130
Stem-loop
   auauagaauaagagaggagaaauccaccagaagcaagccagcuuucc   -         g        c      ug  a   ucu  a 
5'                                                acu ccuggccgg gcucuuuu acauug  cu cug   gc c
                                                  ||| ||||||||| |||||||| ||||||  || |||   ||  
3'                                                uga gggccgguu cgggaaaa uguaac  ga gau   ug c
   -------------------------------cggccacguccaccca   c         a        a      gu  c   cac  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DEVIL7_0) Overlapping transcripts
GL864900.1: 1865338-1865487 [+]
intergenic
Database links

Mature sequence sha-miR-130a

Accession MIMAT0022830
Sequence

101 - 

cagugcaauguaaaaagggca

 - 121

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20044575 "The Tasmanian devil transcriptome reveals Schwann cell origins of a clonally transmissible cancer" Murchison EP, Tovar C, Hsu A, Bender HS, Kheradpour P, Rebbeck CA, Obendorf D, Conlan C, Bahlo M, Blizzard CA, Pyecroft S, Kreiss A, Kellis M, Stark A, Harkins TT, Marshall Graves JA, Woods GM, Hannon GJ, Papenfuss AT Science. 327:84-87(2010).