Stem-loop sequence sha-mir-383

AccessionMI0019658 (change log)
DescriptionSarcophilus harrisii miR-383 stem-loop
Gene family MIPF0000137; mir-383
Stem-loop
   ---------------------------acagcagaagcuccaaa u   c     -c  a      aa      u      uu gg ag 
5'                                             g cac ugcuc  uc gaucag  ggugau guggcu  g  c  a
                                               | ||| |||||  || ||||||  |||||| ||||||  |  |  c
3'                                             c gug acgag  ag cugguc  ucacua caccga  c  g  a
   aggucgaccaacguuuggguuccagggcacuccggguuccgauc u   a     aa  a      gg      -      -- aa gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DEVIL7_0) Overlapping transcripts
GL864737.1: 2362136-2362285 [+]
sense
ENSSHAT00000023617 ; sha-mir-383-201; exon 1
Database links

Mature sequence sha-miR-383

Accession MIMAT0022829
Sequence

31 - 

cagaucagaaggugauuguggc

 - 52

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20044575 "The Tasmanian devil transcriptome reveals Schwann cell origins of a clonally transmissible cancer" Murchison EP, Tovar C, Hsu A, Bender HS, Kheradpour P, Rebbeck CA, Obendorf D, Conlan C, Bahlo M, Blizzard CA, Pyecroft S, Kreiss A, Kellis M, Stark A, Harkins TT, Marshall Graves JA, Woods GM, Hannon GJ, Papenfuss AT Science. 327:84-87(2010).