Stem-loop sequence sha-mir-26a

AccessionMI0019657 (change log)
DescriptionSarcophilus harrisii miR-26a stem-loop
Gene family MIPF0000043; mir-26
Literature search

1 open access papers mention sha-mir-26a
(5 sentences)

Stem-loop
   -------------auccaggauaggcuguguccagcu      -   -------u     -au             -   ca  u 
5'                                      gcaggc cua        ucuug   uacuuguuucugg agg  gc g
                                        |||||| |||        |||||   ||||||||||||| |||  || a
3'                                      cguucg gau        agaac   augaacgaagacc ucc  cg c
   uaagguaccgggucccaucuuuuacuuuuguaccacc      u   ccccuuac     cuu             g   ca  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DEVIL7_0) Overlapping transcripts
GL861726.1: 614962-615111 [-]
sense
ENSSHAT00000011674 ; CTDSP2-201; intron 5
Database links

Mature sequence sha-miR-26a

Accession MIMAT0022828
Sequence

30 - 

ccuauucuugauuacuuguuu

 - 50

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20044575 "The Tasmanian devil transcriptome reveals Schwann cell origins of a clonally transmissible cancer" Murchison EP, Tovar C, Hsu A, Bender HS, Kheradpour P, Rebbeck CA, Obendorf D, Conlan C, Bahlo M, Blizzard CA, Pyecroft S, Kreiss A, Kellis M, Stark A, Harkins TT, Marshall Graves JA, Woods GM, Hannon GJ, Papenfuss AT Science. 327:84-87(2010).