Stem-loop sequence sha-mir-141

Accession MI0019654
Description Sarcophilus harrisii miR-141 stem-loop
Gene family MIPF0000019; mir-8
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-8/mir-141/mir-200_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-8 microRNA precursor (homologous to miR-141, miR-200, miR-236), is a short non-coding RNA gene involved in gene regulation. miR-8 in Drosophila melanogaster is expressed from the 3' arm of related precursor hairpins (represented here), along with miR-200, miR-236, miR-429 and human and mouse homolog miR-141. Members of this precursor family have now been predicted or experimentally confirmed in a wide range of species. The bounds of the precursors are predicted based on conservation and base pairing and are not generally known. The miR-200 family is highly conserved in bilaterian animals, with miR-8 as the sole homolog in Drosophila. This species has accordingly been used heavily in work looking to uncover the biological function of the miR-200 family. miR-8 has been observed at all developmental stages of the embryo, with a complete absence from cultured S2 cells of D. melanogaster. Its expression has been seen to be strongly upregulated in larvae and this expression then sustained through to adulthood.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
auagagaugcuuacugugauuggccagcucuggcccuggccgugc       u    c      --    u           ----     u 
                                             ccagcuc gggg caucuu  ccag gcaguguugga    ucgug a
                                             ||||||| |||| ||||||  |||| |||||||||||    |||||  
                                             gguuggg cccc guagaa  gguc ugucacaaucu    agugc a
-----------------------------caguggcuucccucuu       c    c      au    -           ucga     u 
Get sequence
Genome context
Coordinates (DEVIL7_0) Overlapping transcripts
GL861612.1: 2158436-2158585 [+]
intergenic
Clustered miRNAs
< 10kb from sha-mir-141
sha-mir-200c GL861612.1: 2158021-2158170 [+]
sha-mir-141 GL861612.1: 2158436-2158585 [+]

Mature sequence sha-miR-141

Accession MIMAT0022826
Sequence

101 - 

uaacacugucugguaaagaug

 - 121

Get sequence
Evidence experimental; Solexa [1]

References

1
PMID:20044575 "The Tasmanian devil transcriptome reveals Schwann cell origins of a clonally transmissible cancer" Murchison EP, Tovar C, Hsu A, Bender HS, Kheradpour P, Rebbeck CA, Obendorf D, Conlan C, Bahlo M, Blizzard CA, Pyecroft S, Kreiss A, Kellis M, Stark A, Harkins TT, Marshall Graves JA, Woods GM, Hannon GJ, Papenfuss AT Science. 327:84-87(2010).