Stem-loop sequence sha-let-7i

Accession MI0019650
Description Sarcophilus harrisii let-7i stem-loop
Gene family MIPF0000002; let-7
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled let-7_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The Let-7 microRNA precursor was identified from a study of developmental timing in C. elegans, and was later shown to be part of a much larger class of non-coding RNAs termed microRNAs. miR-98 microRNA precursor from human is a let-7 family member. Let-7 miRNAs have now been predicted or experimentally confirmed in a wide range of species (MIPF000002). miRNAs are initially transcribed in long transcripts (up to several hundred nucleotides) called primary miRNAs (pri-miRNAs), which are processed in the nucleus by Drosha and Pasha to hairpin structures of about ~70 nucleotide. These precursors (pre-miRNAs) are exported to the cytoplasm by exportin5, where they are subsequently processed by the enzyme Dicer to a ~22 nucleotide mature miRNA. The involvement of Dicer in miRNA processing demonstrates a relationship with the phenomenon of RNA interference.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
---------------ccgcuccagcguccgcaccauggcc     u                 u   --------  u     ugu 
                                        cuggc gagguaguaguuugugc guu        gg cgggu   g
                                        ||||| ||||||||||||||||| |||        || |||||   a
                                        gaucg uuccgucaucgaacgcg caa        uc gcccg   c
ggcccgguaacagaagugggcgccgacuaguaguggucgu     -                 u   uagaggug  -     uua 
Get sequence
Genome context
Coordinates (DEVIL7_0) Overlapping transcripts
GL861550.1: 1519507-1519656 [+]
intergenic

Mature sequence sha-let-7i

Accession MIMAT0022822
Sequence

31 - 

ugagguaguaguuugugcugu

 - 51

Get sequence
Evidence experimental; Solexa [1]

References

1
PMID:20044575 "The Tasmanian devil transcriptome reveals Schwann cell origins of a clonally transmissible cancer" Murchison EP, Tovar C, Hsu A, Bender HS, Kheradpour P, Rebbeck CA, Obendorf D, Conlan C, Bahlo M, Blizzard CA, Pyecroft S, Kreiss A, Kellis M, Stark A, Harkins TT, Marshall Graves JA, Woods GM, Hannon GJ, Papenfuss AT Science. 327:84-87(2010).