Stem-loop sequence sha-mir-93

Accession MI0019647
Description Sarcophilus harrisii miR-93 stem-loop
Gene family MIPF0000001; mir-17
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-17_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-17 microRNA precursor family are a group of related small non-coding RNA genes called microRNAs that regulate gene expression. The microRNA precursor miR-17 family, includes miR-20, miR-91, and miR-103. miRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 3' arm of the precursor. The products are thought to have regulatory roles through complementarity to the 3' UTR of mRNA. A screen of 17 miRNAs that have been predicted to regulate a number of breast cancer associated genes found variations in the microRNAs miR-17 and miR-30c-1, these patients were noncarriers of BRCA1 or BRCA2 mutations, lending the possibility that familial breast cancer may be caused by variation in these miRNAs.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
-------------------------------auccuaggucucauca          g   -ca       -     u    g   u  aau 
                                               gucuuggggg cuc   aagugcu guucg gcag uag gu   a
                                               |||||||||| |||   ||||||| ||||| |||| ||| ||   a
                                               cagaaucccc gag   uucacga cgagu cguc auc ca   c
uuccuuuuuguuuguccaaaccuaggauccuuaagguccccggauca          -   cuc       u     -    -   -  acc 
Get sequence
Genome context
Coordinates (DEVIL7_0) Overlapping transcripts
GL856864.1: 887817-887966 [+]
sense
Clustered miRNAs
< 10kb from sha-mir-93
sha-mir-93 GL856864.1: 887817-887966 [+]
sha-mir-25 GL856864.1: 888073-888222 [+]

Mature sequence sha-miR-93

Accession MIMAT0022819
Sequence

31 - 

caaagugcuguucgugcaggu

 - 51

Get sequence
Evidence experimental; Solexa [1]

References

1
PMID:20044575 "The Tasmanian devil transcriptome reveals Schwann cell origins of a clonally transmissible cancer" Murchison EP, Tovar C, Hsu A, Bender HS, Kheradpour P, Rebbeck CA, Obendorf D, Conlan C, Bahlo M, Blizzard CA, Pyecroft S, Kreiss A, Kellis M, Stark A, Harkins TT, Marshall Graves JA, Woods GM, Hannon GJ, Papenfuss AT Science. 327:84-87(2010).