Stem-loop sequence sha-mir-21

AccessionMI0019641 (change log)
DescriptionSarcophilus harrisii miR-21 stem-loop
Gene family MIPF0000060; mir-21
Literature search

1 open access papers mention sha-mir-21
(3 sentences)

Stem-loop
   aauugaucaauguauguuccaucaauccugcuugaauauccacuuuguacccau    -     -   - -    -c  u   ug 
5'                                                       cauc gucug uga c aucu  ca ggc  u
                                                         |||| ||||| ||| | ||||  || |||   
3'                                                       guag cagac auu g uaga  gu cug  a
   -----------------ggguagcugacgacaacgguacucuagguugucaguu    u     u   c a    cu  c   cc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DEVIL7_0) Overlapping transcripts
GL856812.1: 2094225-2094374 [-]
sense
Database links

Mature sequence sha-miR-21

Accession MIMAT0022813
Sequence

96 - 

uagcuuaucagacugauguugacug

 - 120

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20044575 "The Tasmanian devil transcriptome reveals Schwann cell origins of a clonally transmissible cancer" Murchison EP, Tovar C, Hsu A, Bender HS, Kheradpour P, Rebbeck CA, Obendorf D, Conlan C, Bahlo M, Blizzard CA, Pyecroft S, Kreiss A, Kellis M, Stark A, Harkins TT, Marshall Graves JA, Woods GM, Hannon GJ, Papenfuss AT Science. 327:84-87(2010).