miRNA Entry for MI0019640

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-205. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The text in this section is taken from the free, online encyclopedia, Wikipedia. Anyone can edit a Wikipedia page. We hope that experts on particular microRNA sequences will use the links to Wikipedia below to edit the annotation of individual microRNAs, to add information about function, evolution, discovery, and literature references, for example. Any changes that you make will be visible in Wikipedia immediately, and in miRBase within 24 hours.

Editing Wikipedia entries is straightforward. If you haven't edited a page before, you might like to take a look at the following Wikipedia help pages:

You can also create new pages at Wikipedia about microRNA families that do not currently have specific entries there. Please let us know if you do, so we can incorporate your annotation into miRBase, and create the appropriate links from miRBase entries to the relevant Wikipedia pages.

Please note, we're not responsible for the content of Wikipedia pages.

You can read more about miRBase, Wikipedia and community annotation on this blog post.

Please email us for help or with comments about this community annotation initiative.

In molecular biology miR-205 microRNA is a short RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms. They are involved in numerous cellular processes, including development, proliferation, and apoptosis. Currently, it is believed that miRNAs elicit their effect by silencing the expression of target genes. The miR-200 family (miR-200a, miR-200b, miR-200c, miR-141 and miR-429) and miR-205 are frequently silenced in advanced cancer. Studies has shown that by targeting the transcriptional repressors of E-cadherin, ZEB1 and ZEB2, it is involved in epithelial to mesenchymal transition (EMT) and tumor invasion. Recently, miR-200 silencing was also reported in cancer stem cells, implying that miR-200 deregulation is a key event in multiple levels of tumor biology. However, what prevents miR-200 expression remains largely unanswered.

mir-205

miR-205 microRNA secondary structure and sequence conservation
Identifiers
Symbol	mir-205
Rfam	RF00656
miRBase family	MIPF0000058
Entrez	406988
HUGO	31583
OMIM	613147
Other data
RNA type	microRNA
Domain(s)	Eukaryota; Euteleostomi;

In molecular biology miR-205 microRNA is a short RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms. They are involved in numerous cellular processes, including development, proliferation, and apoptosis. Currently, it is believed that miRNAs elicit their effect by silencing the expression of target genes.^[1]

The miR-200 family (miR-200a, miR-200b, miR-200c, miR-141 and miR-429) and miR-205 are frequently silenced in advanced cancer. Studies has shown that by targeting the transcriptional repressors of E-cadherin, ZEB1 and ZEB2, it is involved in epithelial to mesenchymal transition (EMT) and tumor invasion.

Recently, miR-200 silencing was also reported in cancer stem cells, implying that miR-200 deregulation is a key event in multiple levels of tumor biology. However, what prevents miR-200 expression remains largely unanswered.^[2]

1 Genomic locations
2 miR-205 targets
3 Role of miR-205 in Cancer
4 Cellular and Molecular Biological Functions
5 Potentials in clinical applications
6 See also
7 References
8 Further reading
9 External links

[edit] Genomic locations

Members of miR-200 family including miR -205 are found clustered at two locations in the human genome : 1142000 - 1144500 in chromosome 1 and 6942000 - 6944500 in chromosome 12. Short genomic distance between members suggests that they may function collaboratively and are highly related in sequence.^[3]

[edit] miR-205 targets

[edit] Role of miR-205 in Cancer

Studies have demonstrated that miR-205 has a role in both normal development and cancer.

[edit] Breast Cancer

miR-205 was found to be highly expressed in stem cell-enriched populations from the mouse mammary gland, and thus may play a function in normal mammary stem cell maintenance.^[4]

An increasing amount of experimental evidence shows that microRNAs can have a causal role in breast cancer tumorigenesis as a novel class of oncogenes or tumor suppressor genes, depending on the targets they regulate. It was found down-modulated in breast tumors compared with normal breast tissue.^[5]^[6] This down regulation was also observed in breast cancer cell lines, including MCF-7 and MDA-MB-231 compared to the non-malignant cell line MCF-10A. It directly targets HER3 receptor, vascular endothelial growth factor A (VEGF-A) through interaction with putative binding site in the 3'-untranslated region (3'-UTR) of ErbB3 and VEGF-A. miR-205 inhibits the activation of the downstream mediator Akt. miR-205 was found to be able to interfere with the proliferative pathway mediated by HER receptor family.^[5]^[6]

Ectopic expression of miR-205 significantly inhibits cell proliferation and anchorage independent growth, as well as cell invasion. Furthermore, miR-205 was shown to suppress lung metastasis in an animal model.^[5]

[edit] Prostate Cancer

Research has shown that miR-205 was significantly down regulated in prostate cancer compared with match normal tissue. Its re-expression induced apoptosis, cell cycle arrest and results in a mesenchymal-to-epithelial transition, such as up-regulation of E-cadherin and reduction of cell locomotion and invasion, and in the down-regulation of several oncogenes known to be involved in disease progression (i.e., interleukin 6, caveolin-1, EZH2).^[7]

It also impaired cell growth, migration, clonability, and invasiveness of prostate cancer cells. Micro-RNA-205 induced the expression of tumor suppressor genes IL24 and IL32 at both the messenger RNA and protein levels.

miR-205 exerts a tumor-suppressive effect in human prostate by counteracting epithelial-to-mesenchymal transition and reducing cell migration/invasion, at least in part through the down-regulation of protein kinase Cepsilon.^[7] miR-205 activated tumor suppressor genes by targeting specific sites in their promoters. These results corroborate a newly identified function that miRNAs have in regulating gene expression at the transcriptional level. The specific activation of tumor suppressor genes (e.g., IL24, IL32) or other dysregulated genes by miRNA may contribute to a novel therapeutic approach for the treatment of prostate cancer.^[1]

[edit] Bladder Cancer

From a study on transcriptional regulation of the miR-200 and miR-205 loci in bladder tumors and bladder cell lines, the miR-200 and miR-205 loci were found specifically silenced and gain promoter hypermethylation and repressive chromatin marks in muscle invasive bladder tumors and undifferentiated bladder cell lines. miR-200c expression is significantly correlated with early stage T1 bladder tumor progression, and propose miR-200 and miR-205 silencing and DNA hypermethylation as possible prognostic markers in bladder cancer.^[2]

[edit] Lung Cancer

hsa-miR-205 was identified as a highly specific marker for squamous cell lung carcinoma. Hsa-miR-205 is a highly accurate marker for lung cancer of squamous histology. Diagnostic assay can provide highly accurate subclassification of NSCLC patients.^[8]

[edit] Cellular and Molecular Biological Functions

It is still not clear how miR-205 plays in directing stem cell fate. A study on mammary-gland stem or progenitor cells showed that miR-205 over expression led to an expansion of the progenitor-cell population, decreased cell size and increased cellular proliferation.^[4]

Research also shows miR-205 might regulate the expression of the tumor-suppressor protein PTEN. Several other putative and previously validated miR-205 targets include ZEB1 and ZEB2.^[9]

Inhibition of microRNA-205 increased the number of phosphorylated FAK and phosphorylated Pax, and decreased filamentous actin. microRNA-205 has down-regulating effect on cell motility in NHCEKs.^[10]

microRNA-205 (miR-205) and miR-184 coordinately regulate the lipid phosphatase SHIP2 for Akt survival signaling in keratinocytes.^[11]

miR-205 also interacts with a specific target in the 3'-UTR sequence of MED1, which plays an important role in placental development, and silences MED1 expression in human trophoblasts exposed to hypoxia.^[12]

[edit] Potentials in clinical applications

microRNA (miRNA) expression profiles are being intensively investigated for their involvement in carcinogenesis.

Detection of metastatic head and neck squamous cell carcinoma

The presence of cervical lymph node metastases in head and neck squamous cell carcinoma (HNSCC) is the strongest determinant of patient prognosis. Owing to the impact of nodal metastases on patient survival, a system for sensitive and accurate detection is required. Studies has shown that the expression of microRNA-205 (miR-205) is highly specific for squamous epithelium and can be used as a molecular marker for the detection of metastatic HNSCC.^[13]

[edit] See also

MicroRNA

[edit] References

^ ^a ^b Majid S, Dar AA, Saini S, Yamamura S, Hirata H, Tanaka Y, Deng G, Dahiya R (2010). "MicroRNA-205-directed transcriptional activation of tumor suppressor genes in prostate cancer.". Cancer 116 (24): 5637–49. doi:10.1002/cncr.25488. PMID 20737563.
^ ^a ^b Wiklund ED, Bramsen JB, Hulf T, Dyrskjøt L, Ramanathan R, Hansen TB, Villadsen SB, Gao S, Ostenfeld MS, Borre M, Peter ME, Ørntoft TF, Kjems J, Clark SJ. (2010). "Coordinated epigenetic repression of the miR-200 family and miR-205 in invasive bladder cancer.". Int J Cancer 128 (6): 1327–34. doi:10.1002/ijc.25461. PMID 20473948.
^ Gregory PA, Bert AG, Paterson EL, Barry SC, Tsykin A, Farshid G, Vadas MA, Khew-Goodall Y, Goodall GJ (2008). "The miR-200 family and miR-205 regulate epithelial to mesenchymal transition by targeting ZEB1 and SIP1.". Nat Cell Biol 10 (5): 593–601. doi:10.1038/ncb1722. PMID 18376396.
^ ^a ^b Greene SB, Herschkowitz JI, Rosen JM (2010). "The ups and downs of miR-205: Identifying the roles of miR-205 in mammary gland development and breast cancer.". RNA Biol 7 (3): 300–4. doi:10.4161/rna.7.3.11837. PMID 20436283.
^ ^a ^b ^c Iorio MV, Casalini P, Piovan C, Di Leva G, Merlo A, Triulzi T, MÃ©nard S, Croce CM, Tagliabue E (2009). "microRNA-205 regulates HER3 in human breast cancer.". Cancer Res 69 (6): 2195–200. doi:10.1158/0008-5472.CAN-08-2920. PMID 19276373.
^ ^a ^b Wu H, Zhu S, Mo YY (2009). "Suppression of cell growth and invasion by miR-205 in breast cancer.". Cell Res 19 (4): 439–48. doi:10.1038/cr.2009.18. PMC 2664859. PMID 19238171. //www.ncbi.nlm.nih.gov/pmc/articles/PMC2664859/.
^ ^a ^b Gandellini P, Folini M, Longoni N, Pennati M, Binda M, Colecchia M, Salvioni R, Supino R, Moretti R, Limonta P, Valdagni R, Daidone MG, Zaffaroni N (2009). "miR-205 Exerts tumor-suppressive functions in human prostate through down-regulation of protein kinase Cepsilon.". Cancer Res 69 (6): 2287–95. doi:10.1158/0008-5472.CAN-08-2894. PMID 19244118.
^ Lebanony D, Benjamin H, Gilad S, Ezagouri M, Dov A, Ashkenazi K, Gefen N, Izraeli S, Rechavi G, Pass H, Nonaka D, Li J, Spector Y, Rosenfeld N, Chajut A, Cohen D, Aharonov R, Mansukhani M (2009). "Diagnostic assay based on hsa-miR-205 expression distinguishes squamous from nonsquamous non-small-cell lung carcinoma.". J Clin Oncol 27 (12): 2030–7. doi:10.1200/JCO.2008.19.4134. PMID 19273703.
^ Greene SB, Gunaratne PH, Hammond SM, Rosen JM (2010). "A putative role for microRNA-205 in mammary epithelial cell progenitors.". J Cell Sci 123 (Pt 4): 606–18. doi:10.1242/jcs.056812. PMID 20103531.
^ Li J, Bai H, Zhu Y, Wang XY, Wang F, Zhang JW, Lavker RM, Yu J (2010). "Antagomir dependent microRNA-205 reduction enhances adhesion ability of human corneal epithelial keratinocytes.". Chin Med Sci J 25 (2): 65–70. PMID 20598226.
^ Yu J, Peng H, Ruan Q, Fatima A, Getsios S, Lavker RM (2010). "MicroRNA-205 promotes keratinocyte migration via the lipid phosphatase SHIP2.". FASEB J 24 (10): 3950–9. doi:10.1096/fj.10-157404. PMID 20530248.
^ Mouillet JF, Chu T, Nelson DM, Mishima T, Sadovsky Y (2010). "MiR-205 silences MED1 in hypoxic primary human trophoblasts.". FASEB J 24 (6): 2030–9. doi:10.1096/fj.09-149724. PMC 2874470. PMID 20065103. //www.ncbi.nlm.nih.gov/pmc/articles/PMC2874470/.
^ Fletcher AM, Heaford AC, Trask DK (2008). "Detection of metastatic head and neck squamous cell carcinoma using the relative expression of tissue-specific mir-205.". Transl Oncol 1 (4): 202–8. PMC 2582169. PMID 19043531. //www.ncbi.nlm.nih.gov/pmc/articles/PMC2582169/.

[edit] Further reading

^ Majid S, Dar AA, Saini S, Yamamura S, Hirata H, Tanaka Y, Deng G, Dahiya R (2010). "MicroRNA-205–directed transcriptional activation of tumor suppressor genes in prostate cancer". Cancer 116 (24): 5637–49. doi:10.1002/cncr.25488. PMID 20737563.
^ Li J, Bai H, Zhu Y, Wang XY, Wang F, Zhang JW, Lavker RM, Yu J (2010). "Antagomir dependent microRNA-205 reduction enhances adhesion ability of human corneal epithelial keratinocytes.". Chin Med Sci J 25 (2): 65–70. PMID 20598226.
^ Yu J, Peng H, Ruan Q, Fatima A, Getsios S, Lavker RM (2010). "MicroRNA-205 promotes keratinocyte migration via the lipid phosphatase SHIP2.". FASEB J 24 (10): 3950–9. doi:10.1096/fj.10-157404. PMID 20530248.
^ Wiklund ED, Bramsen JB, Hulf T, Dyrskjøt L, Ramanathan R, Hansen TB, Villadsen SB, Gao S, Ostenfeld MS, Borre M, Peter ME, Ørntoft TF, Kjems J, Clark SJ (2011). "Coordinated epigenetic repression of the miR-200 family and miR-205 in invasive bladder cancer". Int J Cancer. 128 (6): 1327–34. doi:10.1002/ijc.25461. PMID 20473948.
^ Greene SB, Herschkowitz JI, Rosen JM (2010). "The ups and downs of miR-205: identifying the roles of miR-205 in mammary gland development and breast cancer". RNA Biol. 7 (3): 300–4. doi:10.4161/rna.7.3.11837. PMID 20436283.
^ Kimura S, Naganuma S, Susuki D, Hirono Y, Yamaguchi A, Fujieda S, Sano K, Itoh H (2010). "Expression of microRNAs in squamous cell carcinoma of human head and neck and the esophagus: miR-205 and miR-21 are specific markers for HNSCC and ESCC.". Oncol Rep 23 (6): 1625–33. PMID 20428818.
^ Greene SB, Gunaratne PH, Hammond SM, Rosen JM (2010). "A putative role for microRNA-205 in mammary epithelial cell progenitors.". J Cell Sci 123 (Pt 4): 606–18. doi:10.1242/jcs.056812. PMID 20103531.
^ Mouillet JF, Chu T, Nelson DM, Mishima T, Sadovsky Y (2010). "MiR-205 silences MED1 in hypoxic primary human trophoblasts.". FASEB J 24 (6): 2030–9. doi:10.1096/fj.09-149724. PMC 2874470. PMID 20065103. //www.ncbi.nlm.nih.gov/pmc/articles/PMC2874470/.
^ Wu H, Mo YY (2009). "Targeting miR-205 in breast cancer.". Expert Opin Ther Targets 13 (12): 1439–48. doi:10.1517/14728220903338777. PMID 19839716.
^ Song H, Bu G (2009). "MicroRNA-205 inhibits tumor cell migration through down-regulating the expression of the LDL receptor-related protein 1.". Biochem Biophys Res Commun 388 (2): 400–5. doi:10.1016/j.bbrc.2009.08.020. PMID 19665999.
^ Iorio MV, Casalini P, Piovan C, Di Leva G, Merlo A, Triulzi T, Ménard S, Croce CM, Tagliabue E (2009). "microRNA-205 regulates HER3 in human breast cancer". Cancer Res. 69 (6): 2195–200. doi:10.1158/0008-5472.CAN-08-2920. PMID 19276373.
^ Lebanony D, Benjamin H, Gilad S, Ezagouri M, Dov A, Ashkenazi K, Gefen N, Izraeli S, Rechavi G, Pass H, Nonaka D, Li J, Spector Y, Rosenfeld N, Chajut A, Cohen D, Aharonov R, Mansukhani M (2009). "Diagnostic assay based on hsa-miR-205 expression distinguishes squamous from nonsquamous non-small-cell lung carcinoma.". J Clin Oncol 27 (12): 2030–7. doi:10.1200/JCO.2008.19.4134. PMID 19273703.
^ Gandellini P, Folini M, Longoni N, Pennati M, Binda M, Colecchia M, Salvioni R, Supino R, Moretti R, Limonta P, Valdagni R, Daidone MG, Zaffaroni N (2009). "miR-205 Exerts tumor-suppressive functions in human prostate through down-regulation of protein kinase Cepsilon". Cancer Res. 69 (6): 2287–95. doi:10.1158/0008-5472.CAN-08-2894. PMID 19244118.
^ Wu H, Zhu S, Mo YY (2009). "Suppression of cell growth and invasion by miR-205 in breast cancer". Cell Res. 19 (4): 439–48. doi:10.1038/cr.2009.18. PMC 2664859. PMID 19238171. //www.ncbi.nlm.nih.gov/pmc/articles/PMC2664859/.
^ Childs G, Fazzari M, Kung G, Kawachi N, Brandwein-Gensler M, McLemore M, Chen Q, Burk RD, Smith RV, Prystowsky MB, Belbin TJ, Schlecht NF (2009). "Low-level expression of microRNAs let-7d and miR-205 are prognostic markers of head and neck squamous cell carcinoma.". Am J Pathol 174 (3): 736–45. doi:10.2353/ajpath.2009.080731. PMID 19179615.
^ Fletcher AM, Heaford AC, Trask DK (2008). "Detection of metastatic head and neck squamous cell carcinoma using the relative expression of tissue-specific mir-205.". Transl Oncol 1 (4): 202–8. PMC 2582169. PMID 19043531. //www.ncbi.nlm.nih.gov/pmc/articles/PMC2582169/.
^ Yu J, Ryan DG, Getsios S, Oliveira-Fernandes M, Fatima A, Lavker RM (2008). "MicroRNA-184 antagonizes microRNA-205 to maintain SHIP2 levels in epithelia.". Proc Natl Acad Sci U S A 105 (49): 19300–5. doi:10.1073/pnas.0803992105. PMC 2587229. PMID 19033458. //www.ncbi.nlm.nih.gov/pmc/articles/PMC2587229/.
^ Markou A, Tsaroucha EG, Kaklamanis L, Fotinou M, Georgoulias V, Lianidou ES (2008). "Prognostic value of mature microRNA-21 and microRNA-205 overexpression in non-small cell lung cancer by quantitative real-time RT-PCR.". Clin Chem 54 (10): 1696–704. doi:10.1373/clinchem.2007.101741. PMID 18719201.
^ Gregory PA, Bert AG, Paterson EL, Barry SC, Tsykin A, Farshid G, Vadas MA, Khew-Goodall Y, Goodall GJ (2008). "The miR-200 family and miR-205 regulate epithelial to mesenchymal transition by targeting ZEB1 and SIP1.". Nat Cell Biol 10 (5): 593–601. doi:10.1038/ncb1722. PMID 18376396.

[edit] External links

Page for mir-205 microRNA precursor family at Rfam

v t e miRNA precursor families

1-100	1 2 6 7 8/141/200 9/79 10 15 16 17 19 21 22 24 26 29 30 31 33 34 46/47/281 92 96

101-200	101 103/107 122 124 126 127 129 130 132 133 134 135 137 138 143 144 145 146 148/152 150 155 156 160 166 172 181 184 191 192/215 194 196 199 200

201+	203 205 208 210 214 218 219 221 223 224 296 338 395 399 433 451

Other	BART1 BART2 BHRF1-1 BHRF1-2 BHRF1-3 Let-7 Lin-4 Lsy-6

Mature sequence sha-miR-205
Accession	MIMAT0022812
Sequence	31 - uccuucauuccaccggagucu - 51 Get sequence
Evidence	experimental; Solexa [1]

miRBase

Stem-loop sequence sha-mir-205

Contents