|
miRBase |
|
Stem-loop sequence sha-mir-205 |
|||||||||||||||||||||||||||||||||||||||||||
| Accession | MI0019640 | ||||||||||||||||||||||||||||||||||||||||||
| Description | Sarcophilus harrisii miR-205 stem-loop | ||||||||||||||||||||||||||||||||||||||||||
| Gene family | MIPF0000058; mir-205 | ||||||||||||||||||||||||||||||||||||||||||
| Community annotation |
This text is a summary paragraph taken from the Wikipedia entry entitled Mir-205. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ... The text in this section is taken from the free, online encyclopedia, Wikipedia. Anyone can edit a Wikipedia page. We hope that experts on particular microRNA sequences will use the links to Wikipedia below to edit the annotation of individual microRNAs, to add information about function, evolution, discovery, and literature references, for example. Any changes that you make will be visible in Wikipedia immediately, and in miRBase within 24 hours. Editing Wikipedia entries is straightforward. If you haven't edited a page before, you might like to take a look at the following Wikipedia help pages: You can also create new pages at Wikipedia about microRNA families that do not currently have specific entries there. Please let us know if you do, so we can incorporate your annotation into miRBase, and create the appropriate links from miRBase entries to the relevant Wikipedia pages. Please note, we're not responsible for the content of Wikipedia pages. You can read more about miRBase, Wikipedia and community annotation on this blog post. Please email us for help or with comments about this community annotation initiative. In molecular biology miR-205 microRNA is a short RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms. They are involved in numerous cellular processes, including development, proliferation, and apoptosis. Currently, it is believed that miRNAs elicit their effect by silencing the expression of target genes. The miR-200 family (miR-200a, miR-200b, miR-200c, miR-141 and miR-429) and miR-205 are frequently silenced in advanced cancer. Studies has shown that by targeting the transcriptional repressors of E-cadherin, ZEB1 and ZEB2, it is involved in epithelial to mesenchymal transition (EMT) and tumor invasion. Recently, miR-200 silencing was also reported in cancer stem cells, implying that miR-200 deregulation is a key event in multiple levels of tumor biology. However, what prevents miR-200 expression remains largely unanswered.
In molecular biology miR-205 microRNA is a short RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms. They are involved in numerous cellular processes, including development, proliferation, and apoptosis. Currently, it is believed that miRNAs elicit their effect by silencing the expression of target genes.[1] The miR-200 family (miR-200a, miR-200b, miR-200c, miR-141 and miR-429) and miR-205 are frequently silenced in advanced cancer. Studies has shown that by targeting the transcriptional repressors of E-cadherin, ZEB1 and ZEB2, it is involved in epithelial to mesenchymal transition (EMT) and tumor invasion. Recently, miR-200 silencing was also reported in cancer stem cells, implying that miR-200 deregulation is a key event in multiple levels of tumor biology. However, what prevents miR-200 expression remains largely unanswered.[2]
[edit] Genomic locationsMembers of miR-200 family including miR -205 are found clustered at two locations in the human genome : 1142000 - 1144500 in chromosome 1 and 6942000 - 6944500 in chromosome 12. Short genomic distance between members suggests that they may function collaboratively and are highly related in sequence.[3] [edit] miR-205 targets[edit] Role of miR-205 in CancerStudies have demonstrated that miR-205 has a role in both normal development and cancer. [edit] Breast CancermiR-205 was found to be highly expressed in stem cell-enriched populations from the mouse mammary gland, and thus may play a function in normal mammary stem cell maintenance.[4] An increasing amount of experimental evidence shows that microRNAs can have a causal role in breast cancer tumorigenesis as a novel class of oncogenes or tumor suppressor genes, depending on the targets they regulate. It was found down-modulated in breast tumors compared with normal breast tissue.[5][6] This down regulation was also observed in breast cancer cell lines, including MCF-7 and MDA-MB-231 compared to the non-malignant cell line MCF-10A. It directly targets HER3 receptor, vascular endothelial growth factor A (VEGF-A) through interaction with putative binding site in the 3'-untranslated region (3'-UTR) of ErbB3 and VEGF-A. miR-205 inhibits the activation of the downstream mediator Akt. miR-205 was found to be able to interfere with the proliferative pathway mediated by HER receptor family.[5][6] Ectopic expression of miR-205 significantly inhibits cell proliferation and anchorage independent growth, as well as cell invasion. Furthermore, miR-205 was shown to suppress lung metastasis in an animal model.[5] [edit] Prostate CancerResearch has shown that miR-205 was significantly down regulated in prostate cancer compared with match normal tissue. Its re-expression induced apoptosis, cell cycle arrest and results in a mesenchymal-to-epithelial transition, such as up-regulation of E-cadherin and reduction of cell locomotion and invasion, and in the down-regulation of several oncogenes known to be involved in disease progression (i.e., interleukin 6, caveolin-1, EZH2).[7] It also impaired cell growth, migration, clonability, and invasiveness of prostate cancer cells. Micro-RNA-205 induced the expression of tumor suppressor genes IL24 and IL32 at both the messenger RNA and protein levels. miR-205 exerts a tumor-suppressive effect in human prostate by counteracting epithelial-to-mesenchymal transition and reducing cell migration/invasion, at least in part through the down-regulation of protein kinase Cepsilon.[7] miR-205 activated tumor suppressor genes by targeting specific sites in their promoters. These results corroborate a newly identified function that miRNAs have in regulating gene expression at the transcriptional level. The specific activation of tumor suppressor genes (e.g., IL24, IL32) or other dysregulated genes by miRNA may contribute to a novel therapeutic approach for the treatment of prostate cancer.[1] [edit] Bladder CancerFrom a study on transcriptional regulation of the miR-200 and miR-205 loci in bladder tumors and bladder cell lines, the miR-200 and miR-205 loci were found specifically silenced and gain promoter hypermethylation and repressive chromatin marks in muscle invasive bladder tumors and undifferentiated bladder cell lines. miR-200c expression is significantly correlated with early stage T1 bladder tumor progression, and propose miR-200 and miR-205 silencing and DNA hypermethylation as possible prognostic markers in bladder cancer.[2] [edit] Lung Cancerhsa-miR-205 was identified as a highly specific marker for squamous cell lung carcinoma. Hsa-miR-205 is a highly accurate marker for lung cancer of squamous histology. Diagnostic assay can provide highly accurate subclassification of NSCLC patients.[8] [edit] Cellular and Molecular Biological FunctionsIt is still not clear how miR-205 plays in directing stem cell fate. A study on mammary-gland stem or progenitor cells showed that miR-205 over expression led to an expansion of the progenitor-cell population, decreased cell size and increased cellular proliferation.[4] Research also shows miR-205 might regulate the expression of the tumor-suppressor protein PTEN. Several other putative and previously validated miR-205 targets include ZEB1 and ZEB2.[9] Inhibition of microRNA-205 increased the number of phosphorylated FAK and phosphorylated Pax, and decreased filamentous actin. microRNA-205 has down-regulating effect on cell motility in NHCEKs.[10] microRNA-205 (miR-205) and miR-184 coordinately regulate the lipid phosphatase SHIP2 for Akt survival signaling in keratinocytes.[11] miR-205 also interacts with a specific target in the 3'-UTR sequence of MED1, which plays an important role in placental development, and silences MED1 expression in human trophoblasts exposed to hypoxia.[12] [edit] Potentials in clinical applicationsmicroRNA (miRNA) expression profiles are being intensively investigated for their involvement in carcinogenesis. Detection of metastatic head and neck squamous cell carcinoma The presence of cervical lymph node metastases in head and neck squamous cell carcinoma (HNSCC) is the strongest determinant of patient prognosis. Owing to the impact of nodal metastases on patient survival, a system for sensitive and accurate detection is required. Studies has shown that the expression of microRNA-205 (miR-205) is highly specific for squamous epithelium and can be used as a molecular marker for the detection of metastatic HNSCC.[13] [edit] See also[edit] References
[edit] Further reading
[edit] External links
|
||||||||||||||||||||||||||||||||||||||||||
| Stem-loop |
-------------------------------------aa caagauga aguu uc c ucuca gcu uccaug ucucuug cuucauuccac ggagucug u ||| |||||| ||||||| ||||||||||| |||||||| a cga agguac ggagaau gaagugaggug cuuuagac u gaaaagaacacagucucaauuagaacuucaccgacgaca cucaguug ---- uc a uaaucGet sequence |
||||||||||||||||||||||||||||||||||||||||||
| Genome context |
|
||||||||||||||||||||||||||||||||||||||||||
Mature sequence sha-miR-205 |
|
| Accession | MIMAT0022812 |
| Sequence |
31 - uccuucauuccaccggagucu - 51 |
| Evidence | experimental; Solexa [1] |
References |
|
| 1 |
PMID:20044575
"The Tasmanian devil transcriptome reveals Schwann cell origins of a clonally transmissible cancer"
Murchison EP, Tovar C, Hsu A, Bender HS, Kheradpour P, Rebbeck CA, Obendorf D, Conlan C, Bahlo M, Blizzard CA, Pyecroft S, Kreiss A, Kellis M, Stark A, Harkins TT, Marshall Graves JA, Woods GM, Hannon GJ, Papenfuss AT
Science. 327:84-87(2010).
|
Comments, questions? Email mirbase@manchester.ac.uk