Stem-loop sequence sha-mir-205

AccessionMI0019640 (change log)
DescriptionSarcophilus harrisii miR-205 stem-loop
Gene family MIPF0000058; mir-205
Stem-loop
   -------------------------------------aa   caagauga      aguu       uc           c        ucuca 
5'                                        gcu        uccaug    ucucuug  cuucauuccac ggagucug     u
                                          |||        ||||||    |||||||  ||||||||||| ||||||||     a
3'                                        cga        agguac    ggagaau  gaagugaggug cuuuagac     u
   gaaaagaacacagucucaauuagaacuucaccgacgaca   cucaguug      ----       uc           a        uaauc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DEVIL7_0) Overlapping transcripts
GL856783.1: 365799-365948 [+]
intergenic
Database links

Mature sequence sha-miR-205

Accession MIMAT0022812
Sequence

31 - 

uccuucauuccaccggagucu

 - 51

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20044575 "The Tasmanian devil transcriptome reveals Schwann cell origins of a clonally transmissible cancer" Murchison EP, Tovar C, Hsu A, Bender HS, Kheradpour P, Rebbeck CA, Obendorf D, Conlan C, Bahlo M, Blizzard CA, Pyecroft S, Kreiss A, Kellis M, Stark A, Harkins TT, Marshall Graves JA, Woods GM, Hannon GJ, Papenfuss AT Science. 327:84-87(2010).