Stem-loop sequence sha-mir-19b

AccessionMI0019636 (change log)
DescriptionSarcophilus harrisii miR-19b stem-loop
Gene family MIPF0000011; mir-19
Literature search

1 open access papers mention sha-mir-19b
(6 sentences)

Stem-loop
   acaacuucauc    -cuuc   u aa      aauuuaag    guu                 -  -      uc    uguau  u 
5'            gcau     ucu c  acuuuu        cacu   cuaugguuaguuuugca gg uuugca  cagc     ga a
              ||||     ||| |  ||||||        ||||   ||||||||||||||||| || ||||||  ||||     ||  
3'            ugua     aga g  ugaaag        gugg   ggugucagucaaaacgu cc aaacgu  gucg     cu u
   -----------    aaaaa   u ac      --------    --u                 a  u      --    ----u  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DEVIL7_0) Overlapping transcripts
GL849858.1: 3486496-3486645 [-]
sense
Database links

Mature sequence sha-miR-19b

Accession MIMAT0022809
Sequence

95 - 

ugugcaaauccaugcaaaacugacug

 - 120

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20044575 "The Tasmanian devil transcriptome reveals Schwann cell origins of a clonally transmissible cancer" Murchison EP, Tovar C, Hsu A, Bender HS, Kheradpour P, Rebbeck CA, Obendorf D, Conlan C, Bahlo M, Blizzard CA, Pyecroft S, Kreiss A, Kellis M, Stark A, Harkins TT, Marshall Graves JA, Woods GM, Hannon GJ, Papenfuss AT Science. 327:84-87(2010).