Stem-loop sequence sha-mir-30e

Accession MI0019634
Description Sarcophilus harrisii miR-30e stem-loop
Gene family MIPF0000005; mir-30
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-30_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-30 microRNA precursor is a small non-coding RNA that regulates gene expression. Animal microRNAs are transcribed as pri-miRNA (primary miRNA) of varying length which in turns are processed in the nucleus by Drosha into ~70 nucleotide stem-loop precursor called pre-miRNA (preliminary miRNA) and subsequently processed by the Dicer enzyme to give a mature ~22 nucleotide product. In this case the mature sequence comes from both the 3' (miR-30) and 5' (mir-97-6) arms of the precursor. The products are thought to have regulatory roles through complementarity to mRNA. A screen of 17 miRNAs that have been predicted to regulate a number of breast cancer associated genes found variations in the microRNAs miR-17 and miR-30c-1, these patients were noncarriers of BRCA1 or BRCA2 mutations, lending the possibility that familial breast cancer may be caused by variation in these miRNAs. Members of the miR-30 family have been found to be highly expressed in heart cells.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
-----------------------------uuccagcucucuu  -        uu   a            uu           g aaggu 
                                          ug ggcagucu  gcc cuguaaacaucc  gacuggaagcu u     g
                                          || ||||||||  ||| ||||||||||||  ||||||||||| |      
                                          ac ccgucgga  cgg gacauuuguagg  cugacuuucga g     c
acuccgucgugacgaagggugggaugaacaccgacccuacgg  a        --   c            --           g agguu 
Get sequence
Genome context
Coordinates (DEVIL7_0) Overlapping transcripts
GL849784.1: 535960-536109 [+]
sense
Clustered miRNAs
< 10kb from sha-mir-30e
sha-mir-30e GL849784.1: 535960-536109 [+]
sha-mir-30c GL849784.1: 539136-539285 [+]

Mature sequence sha-miR-30e

Accession MIMAT0022807
Sequence

31 - 

uguaaacauccuugacuggaagcug

 - 55

Get sequence
Evidence experimental; Solexa [1]

References

1
PMID:20044575 "The Tasmanian devil transcriptome reveals Schwann cell origins of a clonally transmissible cancer" Murchison EP, Tovar C, Hsu A, Bender HS, Kheradpour P, Rebbeck CA, Obendorf D, Conlan C, Bahlo M, Blizzard CA, Pyecroft S, Kreiss A, Kellis M, Stark A, Harkins TT, Marshall Graves JA, Woods GM, Hannon GJ, Papenfuss AT Science. 327:84-87(2010).