Stem-loop sequence sha-mir-150

Accession MI0019633
Description Sarcophilus harrisii miR-150 stem-loop
Gene family MIPF0000197; mir-150
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled MiR-150. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-150 is a family of microRNA precursors found in mammals, including humans. The ~22 nucleotide mature miRNA sequence is excised from the precursor hairpin by the enzyme Dicer. This sequence then associates with RISC which effects RNA interference. miR-150 functions in hematopoiesis; it regulates genes whose downstream products encourage differentiating stem cells towards becoming megakaryocytes rather than erythrocytes. It is also thought to control B and T cell differentiation, alongside mir-155.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
----------------------------------------c c   cc uc    ugu     ag    u       acc        a a   - a 
                                         c agc  g  ugcc   cccgg  cccc ucuccca   cucguacc g guc c u
                                         | |||  |  ||||   |||||  |||| |||||||   |||||||| | ||| |  
                                         g ucg  c  augg   gggcu  gggg agggggu   gggcaugg c cag g c
caggccccucugccggcgagggaccccccggaggaggccga u   -c ga    ---     ga    u       guc        c -   a c 
Get sequence
Genome context
Coordinates (DEVIL7_0) Overlapping transcripts
GL849778.1: 132881-133030 [+]
intergenic

Mature sequence sha-miR-150

Accession MIMAT0022806
Sequence

31 - 

ucucccaacccucguacca

 - 49

Get sequence
Evidence experimental; Solexa [1]

References

1
PMID:20044575 "The Tasmanian devil transcriptome reveals Schwann cell origins of a clonally transmissible cancer" Murchison EP, Tovar C, Hsu A, Bender HS, Kheradpour P, Rebbeck CA, Obendorf D, Conlan C, Bahlo M, Blizzard CA, Pyecroft S, Kreiss A, Kellis M, Stark A, Harkins TT, Marshall Graves JA, Woods GM, Hannon GJ, Papenfuss AT Science. 327:84-87(2010).