Stem-loop sequence sha-mir-7

AccessionMI0019620 (change log)
DescriptionSarcophilus harrisii miR-7 stem-loop
Gene family MIPF0000022; mir-7
Stem-loop
   uuauauagagccuguagaaaauauggaagauuucauu  auau      a  u        a     a       u      --     a 
5'                                      gg    uggccu gu cugugugg agacu gugauuu guuguu  uuuag u
                                        ||    |||||| || |||||||| ||||| ||||||| ||||||  |||||  
3'                                      cc    accgga ca gguauacc ucuga cacuaaa caacag  aaauc a
   -------------------------aauaggacaucu  --gu      -  c        g     -       -      ca     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DEVIL7_0) Overlapping transcripts
GL841540.1: 2528669-2528818 [+]
sense
Database links

Mature sequence sha-miR-7

Accession MIMAT0022793
Sequence

101 - 

caacaaaucacagucugccau

 - 121

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20044575 "The Tasmanian devil transcriptome reveals Schwann cell origins of a clonally transmissible cancer" Murchison EP, Tovar C, Hsu A, Bender HS, Kheradpour P, Rebbeck CA, Obendorf D, Conlan C, Bahlo M, Blizzard CA, Pyecroft S, Kreiss A, Kellis M, Stark A, Harkins TT, Marshall Graves JA, Woods GM, Hannon GJ, Papenfuss AT Science. 327:84-87(2010).