Stem-loop sequence sha-mir-204

AccessionMI0019617 (change log)
DescriptionSarcophilus harrisii miR-204 stem-loop
Gene family MIPF0000042; mir-204
Stem-loop
   gggaaaggagcuucugaccauauaaccauggcuaccgucucucuccaugu   ucg     u          a     u    gagaau 
5'                                                   gac   uggac ucccuuuguc uccua gccu      a
                                                     |||   ||||| |||||||||| ||||| ||||      u
3'                                                   cug   acuug agggaaacgg agggu cggg      a
   ------------------------------aguuuucucuacgguuacua   uug     c          a     -    ggaagu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DEVIL7_0) Overlapping transcripts
GL841514.1: 388049-388198 [+]
intergenic
Database links

Mature sequence sha-miR-204

Accession MIMAT0022790
Sequence

101 - 

gcugggaaggcaaagggacgu

 - 121

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20044575 "The Tasmanian devil transcriptome reveals Schwann cell origins of a clonally transmissible cancer" Murchison EP, Tovar C, Hsu A, Bender HS, Kheradpour P, Rebbeck CA, Obendorf D, Conlan C, Bahlo M, Blizzard CA, Pyecroft S, Kreiss A, Kellis M, Stark A, Harkins TT, Marshall Graves JA, Woods GM, Hannon GJ, Papenfuss AT Science. 327:84-87(2010).