Stem-loop sequence sha-mir-23b

AccessionMI0019614 (change log)
DescriptionSarcophilus harrisii miR-23b stem-loop
Gene family MIPF0000027; mir-23
Stem-loop
   cuuuuguugugaaaguaugaacucaagaggacaccaugauuuucuugagugcuc       u   --          -  c      gugacu 
5'                                                       uggcugc ugg  guuccuggca ug ugauuu      u
                                                         ||||||| |||  |||||||||| || ||||||       
3'                                                       accgacg acc  uagggaccgu ac acuaaa      a
   ----------------------------------accuucucgucgguugcagu       c   au          u  -      auuaga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DEVIL7_0) Overlapping transcripts
GL841474.1: 1159813-1159962 [+]
sense
Clustered miRNAs
< 10kb from sha-mir-23b
sha-mir-23bGL841474.1: 1159813-1159962 [+]
sha-mir-27bGL841474.1: 1160030-1160179 [+]
sha-mir-24-1GL841474.1: 1160603-1160752 [+]
Database links

Mature sequence sha-miR-23b

Accession MIMAT0022788
Sequence

101 - 

aucacauugccagggauua

 - 119

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20044575 "The Tasmanian devil transcriptome reveals Schwann cell origins of a clonally transmissible cancer" Murchison EP, Tovar C, Hsu A, Bender HS, Kheradpour P, Rebbeck CA, Obendorf D, Conlan C, Bahlo M, Blizzard CA, Pyecroft S, Kreiss A, Kellis M, Stark A, Harkins TT, Marshall Graves JA, Woods GM, Hannon GJ, Papenfuss AT Science. 327:84-87(2010).