Stem-loop sequence sha-mir-199a

AccessionMI0019611 (change log)
DescriptionSarcophilus harrisii miR-199a stem-loop
Gene family MIPF0000040; mir-199
Stem-loop
   ucaaaaggaauggcuuuaaaggggaggagaagaaucuucucaaau    -    ca  agc       u        c   - -  --g aa 
5'                                              ucca gccc  cc   ccagugu cagacuac ugu c ca   g  a
                                                |||| ||||  ||   ||||||| |||||||| ||| | ||   |   
3'                                              aggu cggg  gg   gguuaca gucugaug aca g gu   c  u
   ------------------------------gacucagcuacgaaa    u    uc  auu       c        -   u u  aaa gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DEVIL7_0) Overlapping transcripts
GL841403.1: 248906-249055 [+]
antisense
ENSSHAT00000007553 ; DNM2-202; intron 6
ENSSHAT00000007552 ; DNM2-201; intron 14
Database links

Mature sequence sha-miR-199a

Accession MIMAT0022785
Sequence

101 - 

acaguagucugcacauugguu

 - 121

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20044575 "The Tasmanian devil transcriptome reveals Schwann cell origins of a clonally transmissible cancer" Murchison EP, Tovar C, Hsu A, Bender HS, Kheradpour P, Rebbeck CA, Obendorf D, Conlan C, Bahlo M, Blizzard CA, Pyecroft S, Kreiss A, Kellis M, Stark A, Harkins TT, Marshall Graves JA, Woods GM, Hannon GJ, Papenfuss AT Science. 327:84-87(2010).