Stem-loop sequence sha-mir-126

Accession MI0019605
Description Sarcophilus harrisii miR-126 stem-loop
Gene family MIPF0000115; mir-126
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-126. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology mir-126 is a short non-coding RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several pre- and post-transcription mechanisms. mir-126 is a human microRNA that is expressed only in endothelial cells, throughout capillaries as well as larger blood vessels, and acts upon various transcripts to control angiogenesis.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
ggaguccuccaagcuugucuccucuccaccacagaaggaaauucugggcc    a      - u           u       c cug   c 
                                                  gcug cgaugg g cauuauuacuu ugguacg g   uga a
                                                  |||| |||||| | ||||||||||| ||||||| |   |||  
                                                  cgac guuacc c guaauaaugag gccaugc c   acu c
---------------------------------agaaagaacgacggguc    g      g -           u       u -aa   a 
Get sequence
Genome context
Coordinates (DEVIL7_0) Overlapping transcripts
GL834949.1: 4222-4371 [+]
sense

Mature sequence sha-miR-126

Accession MIMAT0022779
Sequence

101 - 

ucguaccgugaguaauaau

 - 119

Get sequence
Evidence experimental; Solexa [1]

References

1
PMID:20044575 "The Tasmanian devil transcriptome reveals Schwann cell origins of a clonally transmissible cancer" Murchison EP, Tovar C, Hsu A, Bender HS, Kheradpour P, Rebbeck CA, Obendorf D, Conlan C, Bahlo M, Blizzard CA, Pyecroft S, Kreiss A, Kellis M, Stark A, Harkins TT, Marshall Graves JA, Woods GM, Hannon GJ, Papenfuss AT Science. 327:84-87(2010).