Stem-loop sequence sha-mir-216a

AccessionMI0019603 (change log)
DescriptionSarcophilus harrisii miR-216a stem-loop
Gene family MIPF0000054; mir-216
Stem-loop
   ------------------------------aaggcuaaccuggauggcugugaa     u         cu   a        -au   a 
5'                                                       uuggc uaaucucag  ggc acugugag   auu a
                                                         ||||| |||||||||  ||| ||||||||   |||  
3'                                                       aaucg auuaggguc  cug ugacacuc   uaa u
   uaaauccaaccacucguucagauaacuagguacucccguuccuuuaacgagaca     u         -u   g        ccu   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DEVIL7_0) Overlapping transcripts
GL834734.1: 1019942-1020091 [+]
intergenic
Database links

Mature sequence sha-miR-216a

Accession MIMAT0022777
Sequence

31 - 

uaaucucagcuggcaacugug

 - 51

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20044575 "The Tasmanian devil transcriptome reveals Schwann cell origins of a clonally transmissible cancer" Murchison EP, Tovar C, Hsu A, Bender HS, Kheradpour P, Rebbeck CA, Obendorf D, Conlan C, Bahlo M, Blizzard CA, Pyecroft S, Kreiss A, Kellis M, Stark A, Harkins TT, Marshall Graves JA, Woods GM, Hannon GJ, Papenfuss AT Science. 327:84-87(2010).