Stem-loop sequence sha-mir-340

AccessionMI0019601 (change log)
DescriptionSarcophilus harrisii miR-340 stem-loop
Stem-loop
   auucccaccuccaauuaaaacacauuggcaucagu    -a   u  ----gcau     a  ca                      auccugc 
5'                                    auga  gga ga        auaca gg  ugacuauaaaguaaugagacug       a
                                      ||||  ||| ||        ||||| ||  ||||||||||||||||||||||       c
3'                                    uacu  ccu cu        uaugu cc  acugauauuucauuacucugac       a
   -----------------------------------    ga   -  agaaauuc     c  ac                      cacaaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DEVIL7_0) Overlapping transcripts
GL834730.1: 741012-741161 [+]
antisense
ENSSHAT00000012518 ; AFTPH-201; intron 5
ENSSHAT00000012519 ; AFTPH-202; intron 5
Database links

Mature sequence sha-miR-340

Accession MIMAT0022775
Sequence

101 - 

agucucauuacuuuauaguca

 - 121

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20044575 "The Tasmanian devil transcriptome reveals Schwann cell origins of a clonally transmissible cancer" Murchison EP, Tovar C, Hsu A, Bender HS, Kheradpour P, Rebbeck CA, Obendorf D, Conlan C, Bahlo M, Blizzard CA, Pyecroft S, Kreiss A, Kellis M, Stark A, Harkins TT, Marshall Graves JA, Woods GM, Hannon GJ, Papenfuss AT Science. 327:84-87(2010).