Stem-loop sequence vun-MIR399b

Accession

MI0019577

Description

Vigna unguiculata miR399b stem-loop

Gene family

MIPF0000015; MIR399

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-399_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

mir-399 is a microRNA that was identified in both Arabidopsis thaliana and Oryza sativa computationally and was later experimentally verified. mir-399 is thought to target mRNAs coding for a phosphate transporter. The mature sequence is excised from the 3' arm of the hairpin. There are multiple copies of MIR399 in each plant genome, for example A. thaliana contains six microRNA precursors that all give rise to an almost identical mature miR-399 sequence.

Stem-loop

--uaa   u ug       c        ugcuacau       u 
     cag g  auucucc uuggcagg        cuauucu c
     ||| |  ||||||| ||||||||        ||||||| a
     guc c  uaagagg aaccgucu        gguaaga u
uuacc   c gu       a        ----uucc       c 

Mature sequence vun-miR399b

• Accession: MIMAT0022764
• Sequence: 60 - ugccaaaggagaauugcccug - 80
• Evidence: not experimental

References

1. "Identification and validation of conserved microRNAs along with their differential expression in roots of Vigna unguiculata grown under salt stress" Paul S, Kundu A, Pal A Plant Cell Tissue Organ Culture. 105:233-242(2011).