Stem-loop sequence vun-MIR399b

AccessionMI0019577 (change log)
DescriptionVigna unguiculata miR399b stem-loop
Gene family MIPF0000015; MIR399
Stem-loop
   --uaa   u ug       c        ugcuacau       u 
5'      cag g  auucucc uuggcagg        cuauucu c
        ||| |  ||||||| ||||||||        ||||||| a
3'      guc c  uaagagg aaccgucu        gguaaga u
   uuacc   c gu       a        ----uucc       c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence vun-miR399b

Accession MIMAT0022764
Sequence

60 - 

ugccaaaggagaauugcccug

 - 80

Get sequence
Evidence not experimental

References

1
"Identification and validation of conserved microRNAs along with their differential expression in roots of Vigna unguiculata grown under salt stress" Paul S, Kundu A, Pal A Plant Cell Tissue Organ Culture. 105:233-242(2011).