Stem-loop sequence ola-mir-9a-5

AccessionMI0019557 (change log)
DescriptionOryzias latipes miR-9a-5 stem-loop
Gene family MIPF0000014; mir-9
Literature search

4 open access papers mention ola-mir-9a-5
(14 sentences)

Stem-loop
   -cgccuga      g c     uc               g      ugccg 
5'         gggguu u uguua  uuugguuaucuagcu uaugag     u
           |||||| | |||||  ||||||||||||||| ||||||      
3'         cccuaa a acaau  aagccaauagaucga auacuu     a
   guacauua      g -     ga               a      cuuuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MEDAKA1) Overlapping transcripts
scaffold7831: 774-875 [+]
intergenic
Database links

Mature sequence ola-miR-9a-3p

Accession MIMAT0022537
Sequence

61 - 

auaaagcuagauaaccgaaag

 - 81

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:21143817 "Discovery and characterization of medaka miRNA genes by next generation sequencing platform" Li SC, Chan WC, Ho MR, Tsai KW, Hu LY, Lai CH, Hsu CN, Hwang PP, Lin WC BMC Genomics. 11 Suppl 4:S8(2010).