Stem-loop sequence ola-mir-210

AccessionMI0019554 (change log)
DescriptionOryzias latipes miR-210 stem-loop
Gene family MIPF0000086; mir-210
Stem-loop
   ucc   ----        g     a    a   acua       uu   c  gu 
5'    gag    uucuaaaa caggu agcc cug    acgcaca  gug gu  g
      |||    |||||||| ||||| |||| |||    |||||||  ||| ||  a
3'    cuc    aggguuuu gucca ucgg gac    ugcgugu  cac ua  c
   agu   caaa        g     a    c   agug       --   c  ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MEDAKA1) Overlapping transcripts
scaffold676: 57142-57246 [+]
intergenic
Database links

Mature sequence ola-miR-210-5p

Accession MIMAT0022660
Sequence

22 - 

agccacugacuaacgcacau

 - 41

Get sequence
Evidence experimental; SOLiD [1]

Mature sequence ola-miR-210-3p

Accession MIMAT0022661
Sequence

60 - 

acugugcgugugacagcg

 - 77

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:21143817 "Discovery and characterization of medaka miRNA genes by next generation sequencing platform" Li SC, Chan WC, Ho MR, Tsai KW, Hu LY, Lai CH, Hsu CN, Hwang PP, Lin WC BMC Genomics. 11 Suppl 4:S8(2010).