Stem-loop sequence ola-mir-183-2

AccessionMI0019548 (change log)
DescriptionOryzias latipes miR-183-2 stem-loop
Gene family MIPF0000066; mir-183
Literature search

1 open access papers mention ola-mir-183-2
(2 sentences)

Stem-loop
   uga   c        g      --ac     ga       ----    g 
5'    cuc uguucugu uauggc    uggua  auucacu    guga a
      ||| |||||||| ||||||    |||||  |||||||    ||||  
3'    gag acgagaca auaccg    accau  uaaguga    cacu g
   aaa   -        a      ggau     --       cuau    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MEDAKA1) Overlapping transcripts
23: 14604483-14604573 [+]
intergenic
Clustered miRNAs
< 10kb from ola-mir-183-2
ola-mir-183-223: 14604483-14604573 [+]
ola-mir-18223: 14604891-14604991 [+]
Database links

Mature sequence ola-miR-183-5p

Accession MIMAT0022555
Sequence

18 - 

auggcacugguagaauuca

 - 36

Get sequence
Evidence experimental; SOLiD [1]

Mature sequence ola-miR-183-3p

Accession MIMAT0022556
Sequence

56 - 

gugaauuaccauagggccaua

 - 76

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:21143817 "Discovery and characterization of medaka miRNA genes by next generation sequencing platform" Li SC, Chan WC, Ho MR, Tsai KW, Hu LY, Lai CH, Hsu CN, Hwang PP, Lin WC BMC Genomics. 11 Suppl 4:S8(2010).