Stem-loop sequence ola-mir-29b-2

AccessionMI0019545 (change log)
DescriptionOryzias latipes miR-29b-2 stem-loop
Gene family MIPF0000009; mir-29
Literature search

2 open access papers mention ola-mir-29b-2
(16 sentences)

Stem-loop
   -----    gucu          -          c      gu       uguc 
5'      guug    ucccuaagaa gcugguuuca guggug  uuagaug    u
        ||||    |||||||||| |||||||||| ||||||  |||||||    u
3'      cgac    agggguucuu ugacuaaagu uaccac  gaucugu    u
   cagga    ----          g          u      --       uguc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MEDAKA1) Overlapping transcripts
23: 8740355-8740453 [+]
intergenic
Clustered miRNAs
< 10kb from ola-mir-29b-2
ola-mir-29b-223: 8740355-8740453 [+]
ola-mir-29c23: 8740492-8740593 [+]
Database links

Mature sequence ola-miR-29b

Accession MIMAT0022569
Sequence

60 - 

uagcaccauuugaaaucagugu

 - 81

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:21143817 "Discovery and characterization of medaka miRNA genes by next generation sequencing platform" Li SC, Chan WC, Ho MR, Tsai KW, Hu LY, Lai CH, Hsu CN, Hwang PP, Lin WC BMC Genomics. 11 Suppl 4:S8(2010).